Review



cell lines vero e6 atcc cat  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC cell lines vero e6 atcc cat
    Cell Lines Vero E6 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 17988 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+vero+e6+cell+line+atcc+cat/Vero/10__1016_slash_j__isci__2025__113394-230-7-11
    Average 99 stars, based on 17988 article reviews
    cell lines vero e6 atcc cat - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Enzyme-linked Immunosorbent Assay:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    Luciferase:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    Bicinchoninic Acid Protein Assay:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    Single Cell:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    Polymerase Chain Reaction:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    Random Hexamer:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    Recombinant:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    Expressing:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    Plasmid Preparation:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    Mutagenesis:

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD19 V421 BD Biosciences Cat#562440 IgM PerCP-Cy5.5 BD Biosciences Cat#561285 CD27 PE BD Biosciences Cat#340425 IgD-A700 BD Biosciences Cat#561302 CD3 PE-Cy7 BioLegend Cat#300420 CD14 PE-Cy7 BioLegend Cat#301814 CD56 PECy7 Biolegend Cat#318318 Strep-TactinTMXT DY-649 iba-lifesciences Cat#2-1568-050 Strep-TactinXT DY-488 iba-lifesciences Cat#2-1562-050 Live/Dead Fixable Aqua InvitrogenTM Cat# L34957 goat anti-rabbit antibody against C3-FITC MP Biomedicals Cat# 0855654 Goat Anti-Human IgA-UNLB Southern Biotech Cat#2050-01 Goat Anti-Human IgA-Alkaline Phosphatase Southern Biotech Cat#2050-04 Human IgA-UNLB Southern Biotech Cat# 0155L-01 Human IgG-UNLB Southern Biotech Cat# 0150-01 Goat Anti-Human IgG-UNLB Southern Biotech Cat#2040-01 Goat Anti-Human IgG-AP Southern Biotech Cat#2040-04 Bacterial and virus strains SARS-CoV-2 wild type EVAg GenBank: MT066156 SARS-CoV-2 BA.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13389618 SARS-CoV-2 BA.2.75 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_14732896 SARS-CoV-2 BF.7 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_13499917 SARS-CoV-2 BQ.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_15455664 SARS-CoV-2 XBB.1.5 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_17272995 SARS-CoV-2 EG.5.1.1 KU Leuven, Rega Institute, Clinical and Epidemiological Virology, Leuven, Belgium GISAID ID: EPI_ISL_18245523 SARS-CoV-2 BA.2.86 National Reference Center for Viruses of Respiratory Infections, Institut Pasteur, Paris, France GISAID ID: EPI_ISL_18221650 Biological samples PBMCs and IgGs of donor SN2_PT-001 Andreano et al.7 N/A PBMCs and IgGs of donor SN2_PT-002 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-003 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-004 Andreano et al.7 N/A PBMCs and IgGs of donor SP2_PT-005 Andreano et al.7 N/A (Continued on next page) Cell Reports 43, 114645, September 24, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER HiTrap Protein G HP column Cytiva Cat#17040503 HisTrap FF Crude column Cytiva Cat#17528601 Bovine Serum Albumin Sigma Cat# A2153 TMB HRP Microwell substrate BETHYL Cat# E102 Alkaline Phosphatase Yellow (pNPP) Sigma-Aldrich Cat# P7998 IgG-Peroxidase antibody Sigma-Aldrich Cat# A0293 True Nuclear Transcription Factor Buffet set BioLegend Cat# 424401 Tween 20 VWR Cat#A4974.0250 Critical commercial assays ELISA Starter Accessory Kit Bethyl Laboratories Cat#E101 Alexa FluorTM 488 NHS Ester InvitrogenTM Cat#A20100 Alexa FluorTM 647 NHS Ester InvitrogenTM Cat#A20006 Alexa FluorTM 594 NHS Ester InvitrogenTM Cat#A20004 ZebaTM Spin Desalting Columns Thermo ScientificTM Cat#89890 DynabeadsTM His-Tag InvitrogenTM Cat#10103D Bright-Glo Luciferase Assay System Promega Cat# E2620 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Deposited data Sequences of SARS-CoV-2-neutralizing antibodies This paper https://github.com/dasch-lab/ SARS-CoV-2_superhybrid Experimental models: cell lines VERO E6 cell line ATCC CatCRL-1586 Expi293FTM cells GibcoTM Cat#A14527 THP-1 ATCC Cat#IB-202 ExpiCHO-STM Cells GibcoTM Cat# A29127 HEK293TN-hACE2 System Bioscience Cat# LV900A-1 HUH7 cell line Japanese Collection of Research Bioresources (JCRB) JCRB-0403 CHO-K1 cell line ATCC CCL-61 HEKTN/17 cell line ATCC CRL-11268 3T3-msCD40L Cells NIH AIDS Reagent Program Cat#12535 Oligonucleotides Single cell PCR Primer This paper N/A Random Hexamer Primer Thermo Fisher Cat#SO142 TAP forward primer (TTAGGCACCCCAGGCTTTAC) This paper N/A TAP forward primer (AGATGGTTCTTTCCGCCTCA) This paper N/A Recombinant DNA Human antibody expression vectors (IgG1, Igl, Igk) Tiller et al.49 N/A Plasmid encoding SARS-CoV-2 S ectodomain (amino acids 1–1208 of SARS-CoV-2 S; GenBank: MN908947) Wrapp et al.50 N/A Plasmid encoding SARS-CoV-2 RBD (amino acids 319–591 of SARS-CoV-2 S; GenBank: MN908947) Jason McLellan Lab N/A pCDNA3.1+-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) codon optimised Andreano et al.6 pCDNA-S2 pCAGGS-SARS-CoV-2 Spike from Wuhan-Hu-1 isolate (GenBank MN908947.3) encoding D614G mutation and codon optimised Andreano et al.6 pCAGGS-S2 D614G (Continued on next page) Cell Reports 43, 114645, September 24, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com

    other:

    Article Title: SARS-CoV-2 escapes direct NK cell killing through Nsp1-mediated downregulation of ligands for NKG2D.
    Article Snippet: N/A Bacterial and virus strains icSARS-CoV-2/WA-01-mNeonGreen Lab of Dr. Pei-Yong Shi https://www.ncbi.nlm.nih.gov/ pmc/articles/PMC7153529/ Chemicals, peptides, and recombinant proteins DNA/RNA Shield Zymo Research Cat#R1100-250 16% paraformaldehyde Electron Microscopy Sciences Cat#15710 RNA Clean & Concentrator Kit Zymo Research Cat#R1018 TURBO DNA-free Kit Fisher Scientific Cat#AM1907 Brefeldin A eBioscience Cat#00-4506-51 Monensin eBioscience Cat#00-4505-51 10x Permeabilization Buffer BD Biosciences Cat#340973 rhIL-2 R&D Systems Cat#202-IL-010 MACS Human NK Cell Isolation Kit Miltenyi Cat#130-092-657 PBS ThermoFisher Scientific Cat#10010023 DMEM Life Technologies Cat#11885–092 TrypLE ThermoFisher Scientific Cat#12604021 MG-132 abcam Cat#ab141003 BAF-A1 Millipore Sigma Cat#SML1661-.1ML Fugene HD Promega Cat#E2311 Lipofectamine 3000 ThermoFisher Scientific Cat#L3000001 Triton-X 100 Sigma-Aldrich Cat#T9284-100ML Critical commercial assays Invitrogen superscript III Platinum One Step qRT PCR Kit with ROX Invitrogen Cat#11745500 Human MICA DuoSet ELISA R&D Systems Cat#DY1800 Human ULBP-2 DuoSet ELISA R&D Systems Cat#DY1298 Experimental models: Cell lines Vero E6 cell line ATCC Cat#CRL-1586 K562 cell line ATCC Cat#CCL-243 293T cell line ATCC Cat#CRL-3216 CEM.NKR HIV Reagent Program Cat#ARP-5198 A549-ACEs Lab of Dr. Ralf Bartenschlager Oligonucleotides MICA RT-qPCR primer-probe kit ThermoFisher Scientific Assay ID: Hs07292198_gH MICB RT-qPCR primer-probe kit ThermoFisher Scientific Assay ID: Hs00792952_m1 ULBP1 RT-qPCR primer-probe kit ThermoFisher Scientific Assay ID: Hs0036941_m1 ULBP2 RT-qPCR primer-probe kit ThermoFisher Scientific Assay ID: Hs01127964_m1 SARS-CoV-2 N RT-qPCR fwd primer Biosearch Technologies Cat#nCoV-N1-F-100 SARS-CoV-2 N RT-qPCR rev primer Biosearch Technologies Cat#nCoV-N1-R-100 SARS-CoV-2 N RT-qPCR probe Biosearch Technologies Cat#nCoV-N1-P-25 18S control RT-qPCR primer-probe kit ThermoFisher Scientific Cat#4352930E (Continued on next page) Cell Reports 41, 111892, December 27, 2022 e1

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com Article ll OPEN ACCESS

    Article Title: Antigenic sin and multiple breakthrough infections drive converging evolution of COVID-19 neutralizing responses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCAGGS-SARS1 Spike protein codon optimised Carnell et al.51 pCAGGS-S1 pCAGGS-MERS Spike protein codon optimised Grehan et al.52 pCAGGS-MERS 229E SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A OC43 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A HKU1 SPIKE plasmid pcDNA3.1 Viral Pseudotype Unit, University of Kent N/A pCSFLW Firefly luciferase encoding plasmid Carnell et al.53 pCSFLW SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 Addgene #170447 p8.91 HIV Gag/Pol-encoding plasmid Carnell et al.53 p8.91 Software and algorithms Prism 8 GraphPad https://www.graphpad.com/ FlowJo 10.5.3 FlowJo, LLC https://www.flowjo.com Cloanalyst BU, Computational Immunology http://www.bu.edu/computationalimmunology/ research/software/ R package stringdistm v0.9.8 CRAN https://cran.r-project.org/web/packages/ stringdist/index.html R package ggraph v2.0.5 CRAN https://ggraph.data-imaginist.com/index.html ggplot2 v3.3.5 ggplot2 https://ggplot2.tidyverse.org/index.html Matplotlib v3.2.2 NumFOCUS https://matplotlib.org pandas v1.3.5 NumFOCUS https://pandas.pydata.org Python v3.7.12 Python Software Foundation https://www.python.org FACSDiva BD Bioscences https://www.bdbiosciences.com Other BD FACSAriaTM Fusion BD Biosciences https://www.bdbiosciences.com BD FACSymphonyTM A3 BD Biosciences https://www.bdbiosciences.com Leica DMI-microscope Leica Biosystem https://www.leica-microsystems.com LUNA-II Automated Cell Counter Logo Biosystems https://logosbio.com Qubit Fluorometric Quantification Thermo Fisher https://www.thermofisher.com ÄKTA go Cytiva Lifesciences https://www.cytivalifesciences.com GloMax Luminometer Promega https://ita.promega.com Varioskan LUX multimode microplate reader Thermo Fisher https://www.thermofisher.com



    Similar Products

    cell lines vero e6 atcc cat  (ATCC)
    99
    ATCC cell lines vero e6 atcc cat
    Cell Lines Vero E6 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+vero+e6+cell+line+atcc+cat/Vero/10__1016_slash_j__isci__2025__113394-230-7-11
    Average 99 stars, based on 1 article reviews
    cell lines vero e6 atcc cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines simian kidney vero e6 atcc cat  (ATCC)
    99
    ATCC cell lines simian kidney vero e6 atcc cat
    Cell Lines Simian Kidney Vero E6 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+vero+e6+cell+line+atcc+cat/Vero/pm40286790-245-182-188
    Average 99 stars, based on 1 article reviews
    cell lines simian kidney vero e6 atcc cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines vero e6 cell line atcc cat  (ATCC)
    99
    ATCC cell lines vero e6 cell line atcc cat
    Cell Lines Vero E6 Cell Line Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+vero+e6+cell+line+atcc+cat/Vero/pmc11422482__mmc2-195-125-131
    Average 99 stars, based on 1 article reviews
    cell lines vero e6 cell line atcc cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results